1. 5' ATGGCAACCCAGGGTAGTTTG 3' is the beginning of the coding sequence of DNA for a polypeptide. For the following be sure to label the 5' and 3' ends of the molecules and draw all molecules 5' to 3'.
a. What is the sequence of the template strand?
b. What is the sequence of the complementary strand?
c. What is the sequence of the appropriate region of the mRNA?
d. What is the sequence of the anticodon for the third codon?
2. By looking at the chart for the genetic code:
a. Determine which codons can be mutated by a single base change to produce an amber codon (TAG). What amino acids are endcoded by these codons?
b. The mutagen ethyl methane sulfanate (EMS) causes G to A or C to T mutations. Which of the possibilities in part a could arise with EMS?
c. Of the possibilities in part b, which could be suppressed by amber nonsense suppressor tRNAs generated by EMS?
3. Identify and distinguish between the following:
a. Codon and anticodon.
b. Template strand and coding strand.
c. Pribnow and Shine-Delgarno sequences.
4. Answer TRUE or FALSE. If the statement is TRUE, explain or give a supporting example. If the statement is FALSE, either correct the statement or give a counterexample.
a. Wobble allows a codon in mRNA to hybridize to more than one tRNA..
b. A frameshift mutation causes a change in a single amino acid in the resulting polypeptide.
c. Three different codons code for the start of protein synthesis.
d. The Wobble base is the third base (5' to 3') of the anticodon.
e. RNA can be used as a template to make DNA.
f. Termination codons can be due to single base pair substitutions in a gene.
g. The Wobble Hypothesis explains how alternate base pairing can occur with the third nucleotide (going from 5' to 3') in the anticodon.
5. The direction of RNA synthesis was determined by growing bacteria for a short period of time with trinucleotides labeled with tritium (3H) on their bases. The structure of RNA looks like : 5' pppNpNpNpNp...N-OH 3' (N = nucleosides; p = phosphates). Cleavage of RNA by alkali occurs after the 3' phosphate.
a. What products are produced if RNA is digested with alkali?
b. The products obtained in Part a can be distinguished by thin layer chromatography. Which of the products would you expect to be differentially labeled if new nucleotides are added at the 5' end (i.e., synthesis is in the 3' to 5' direction)?
c. Which products would be differentially labeled if RNA is synthesized from the 5' to 3' direction?
d. When the experiment was done the tritium label was found in the spot containing N-OH? In which direction is RNA synthesized.
6. Distinguish between nonsense vs. missense