1. Bacteria were infected with a phage (a bacterial virus). The phage underwent synchronous replication in the presence of radioactive phosphates for about one minute. Replication was terminated by breaking open the bacterial cells. The phage DNA was extracted and heat denatured (to separate strands), and the radioactive DNA was examined. Much of the DNA looked as shown in the diagram. Which replication reactions have (clearly) already occurred, and which reactions have obviously not occurred? What enzymes are needed for these reactions?

2. Identify and distinguish between the following:

1. The action of DNA polymerase I and DNA polymerase III in DNA replication.

2. The action of helicase and gyrase in DNA replication.

3. Deoxyribonucleotides and dideoxyribonucleotides.

3. A series of drugs are found that inhibit proteins that are needed for DNA replication.  For each compound say what the affected protein normally does in DNA replication and describe the state of the nucleic acids after the drug had acted.

1. Drug A: ligase

2. Drug B: DNA polymerase III

3. Drug C: SSB

4. Drug D: gyrase

5. Drug E: primase

4. A series of DNA replication mutants were identified in E. coli. Given the described phenotypes, determine which enzyme is probably defective. Explain you answer.

1. Strain A: Single Stranded Binding protein binds to open DNA but nothing is copied.

2. Strain B: All the DNA has been replicated, but it is not one long continual strand (i.e., there are nicks)

3. Strain C: Knotted DNA halts DNA synthesis.

4. Strain D: All the replicated DNA has RNA at it 5' end

5. Answer TRUE or FALSE. If the statement is TRUE, explain or give a supporting example.  If the statement is FALSE, either correct the statement or give a counterexample.

1. When the temperature of a DNA solution is raised, the first nucleotide base pairs to "melt" are the G-C base pairs.

2. DNA polymerase I synthesizes DNA from an RNA primer during DNA replication.

3. More stringent conditions would be needed to make single stranded DNA from AT-rich double-stranded DNA than from GC-rich double-stranded DNA.

6. Distinguish between nick translation vs random priming

7. 5' ATGGCAACCCAGGGTAGTTTG 3' is the beginning of the coding sequence of DNA for a polypeptide. For the following be sure to label the 5' and 3' ends of the molecules and draw all molecules 5' to 3'.

1. What is the sequence of the template strand? 

2. What is the sequence of the complementary strand? 

3. What is the sequence of the appropriate region of the mRNA? 

4. What is the sequence of the anticodon for the third codon? 

8. By looking at the chart for the genetic code:

1. Determine which codons can be mutated by a single base change to produce an amber codon (TAG).  What amino acids are endcoded by these codons?

2. The mutagen ethyl methane sulfanate (EMS) causes G to A or C to T  mutations.  Which of the possibilities in part a could arise with EMS?

3. Of the possibilities in part b, which could be suppressed by amber nonsense suppressor tRNAs generated by EMS?

9. Identify and distinguish between the following:

   1. Codon and anticodon.

   2. Template strand and coding strand.

10. Answer TRUE or FALSE. If the statement is TRUE, explain or give a supporting example. If the statement is FALSE, either correct the statement or give a counterexample.

    1. Wobble allows a codon in mRNA to hybridize to more than one tRNA..

    2. A frameshift mutation causes a change in a single amino acid in the resulting polypeptide.

    3. Three different codons code for the start of protein synthesis.

    4. The Wobble base is the third base (5' to 3') of the anticodon.

    5. RNA can be used as a template to make DNA.

    6. Termination codons can be due to single base pair substitutions in a gene.

    7. The Wobble Hypothesis explains how alternate base pairing can occur with the third nucleotide (going from 5' to 3') in the anticodon.

11. The direction of RNA synthesis was determined by growing bacteria for a short period of time with trinucleotides labeled with tritium (³H) on their bases. The structure of RNA looks like : 5' pppNpNpNpNp...N-OH 3' (N = nucleosides; p = phosphates). Cleavage of RNA by alkali occurs after the 3' phosphate.

    1. What products are produced if RNA is digested with alkali?

    2. The products obtained in Part a can be distinguished by thin layer chromatography. Which of the products would you expect to be differentially labeled if new nucleotides are added at the 5' end (i.e., synthesis is in the 3' to 5' direction)?

    3. Which products would be differentially labeled if RNA is synthesized from the 5' to 3' direction?

    4. When the experiment was done the tritium label was found in the spot containing N-OH? In which direction is RNA synthesized.

12. Distinguish between nonsense vs. missense

Answers